genoma.unsam.edu.ar :: tca :: tca-01b13.b1MT

Sequence

>tca-01b13.b1MT
CCACGCGTCCGAGTCCTTCCTCATTAAGGAAGATCCAACCCTCCTGCGCTTCGTGTACTC
GCGCAAGGATGATCTCAATGAGGGGAATCCGGTGCGTTTTACGGGACTTGTGCCGTACCA
TGAGGGTCGCTACACTGGAACAGGCGATGTCTTCGCGGCCACACTGCTTGCCTTTGCTCA
TGAGCTCCCGTTGGAAGCGGCAATCGGAAAGACAATGGGCGTCCTCCAGGATCTCATCAT
CGCCACACGCCACGCTGGTGGTGATGAAAAGAGTTCTCTTAATTGTCGCGAATTGCGCGT
GACCAAATCACCTAACGCACTGGTCAAGCCGTCAGTTGAAATCTAGGTAACTCGACTGTA
ACGCAGTCCAGGTCTATAAAAGGTAAAGGAAAAGGTTTTCATATCTTTCTATATATATAT
ATATATATATATATAT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAC61803.1| (U96712) pyridoxine/pyridoxal/pyridoxamine kinase [Trypanosoma brucei]   Goto GenBank  
Score: 132  Expect: 5e-30
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.0684  coding