genoma.unsam.edu.ar :: tca :: tca-01b20.b1MT

Sequence

>tca-01b20.b1MT
CATATGCAGGGATATTCTTCAACTTATCGACAAGTACCTTCTTCCCAGTGCGAACACAGA
CGAGACGCGGGTGTACTACCTCAAGATGAAGGGCGACTACCACCGGTACTACGCGGAGAT
TGAGACAAACACAGAGGAACAGAAGAACAAAGCACTTGCAGCATACACCGAG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q26537|1432_SCHMA 14-3-3 PROTEIN HOMOLOG 2 (14-3-3-2)   Goto Swissprot  
Score: 104  Expect: 1e-22
nr  BLAST report  
emb|CAC35518.1| (AJ306572) 14-3-3-like protein [Trypanosoma brucei brucei]   Goto GenBank  
Score: 158  Expect: 5e-38
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1199  coding