genoma.unsam.edu.ar :: tca :: tca-01f12.b1

Sequence

>tca-01f12.b1
CCACGCGTCCGGCCGTAGGCTGCTGCTGCGGCAGCGGCTGACGATGAGGAGGATGAGGCG
CCGAAGGAGAAGAAGAAGCCGAACCCGCTGGACGAACTTCCGCCGAGCTCGTTTGTGCTC
GACGCGTTCAAGCGTGAGTACAGCAACACGGACACGCGGACGGTGGCCGCGCCATACTTC
TTCAATAACTTTGACGCTGCGGGCTTCTCGGCCTTCTGGTGCCGCTACAAGTATAATGAG
GACAACAAGATGCAGTTCATGACGGCAAACCTGATTCGTGGGTGGTTCCAGCGCATGGAA
CATACGCGGAAATACGCCTTTGGTGTTGCCCTCATCATTGGTGAGGACAAGAAGCATGAT
ATTGTGGCACTGTGGATCT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P34715|EF1G_TRYCR ELONGATION FACTOR 1-GAMMA (EF-1-GAMMA) (EEF-1B GAMMA)   Goto Swissprot  
Score: 271  Expect: 1e-72
nr  BLAST report  
sp|P34715|EF1G_TRYCR ELONGATION FACTOR 1-GAMMA (EF-1-GAMMA) (EEF-1B GAMMA) pir||S41648 translation elongation factor eEF-1 gamma - Trypanosoma cruzi gb|AAA02936.1| (L17307) elongation factor 1-gamma [Trypanosoma cruzi]   Goto GenBank  
Score: 271  Expect: 7e-72
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.9979  coding