genoma.unsam.edu.ar :: tca :: tca-01g13.b1

Sequence

>tca-01g13.b1
CCACGCGTCCGGGATAAGGTGGTGAATCAGTGTTTCCACAGCGTTACTTTGAGGACGAGG
GATTCGGCTCAGTTTCACACGACTGTCGTGGTGTCGTGTCGATGGCGCACAAAGGCAACA
AGCCTGATACGAATGCTTCACAATTTTTTATTCTATTTGAACCCTGTCTCTCTCTCGATG
GAAAACATACTGCTTTCGGTTTTGTTGACATGGAGTGGAACGAAGGTGAGAGTGAGAAGA
CCTTGAAGCGACTTGAAGAATTGCCAATTGATGAAAAATACAATGTCCTTGAAAAGGAGG
CAAAAATTCTTGAAGC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P52012|CYP4_CAEEL PEPTIDYL-PROLYL CIS-TRANS ISOMERASE 4 (PPIASE) (ROTAMASE) (CYCLOPHILIN-4)   Goto Swissprot  
Score: 79.0  Expect: 6e-15
nr  BLAST report  
gb|AAF89247.1|AF286042_1 (AF286042) cyclophilin [Trypanosoma cruzi]   Goto GenBank  
Score: 186  Expect: 2e-46
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.0528  coding