genoma.unsam.edu.ar :: tca :: tca-01i9.b1

Sequence

>tca-01i9.b1
CCACGCGTCCGGAATACTATTGGAGACTTGATACCGATTCGTTTCTCACCAAGCCTGTGC
CTTGTGACATATTTCAACTGATGAGGGCAAACGAATGTGTGTATGGATATCGTTGGATTG
AACCAGACCATAAAGATGTTGTCGAGAAGTTGTGGCCCACCTTTTTGCGTTGGGCATTTG
GTGTACTTTCTCGTGGAGAGATACAGTACATTAGGGATTTCGCTACCAACAGTGGTACAT
ATTCTCGCATAATGTACTACAACAACTTTGAGCTTGGCAAGATATCGGTTAAGCGGCATC
CGTTATATCAGTCGATGTTTCGTGCCCTGGATGAAGAAGATCCACGGGGAATGATGCGGT
ACCGGTGGGGGGATGCGCCTATCCAT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q00310|KRE2_CANAL GLYCOLIPID 2-ALPHA-MANNOSYLTRANSFERASE (ALPHA-1,2-MANNOSYLTRANSFERASE)   Goto Swissprot  
Score: 74.7  Expect: 1e-13
nr  BLAST report  
sp|Q00310|KRE2_CANAL GLYCOLIPID 2-ALPHA-MANNOSYLTRANSFERASE (ALPHA-1,2-MANNOSYLTRANSFERASE) emb|CAA67930.1| (X99619) putative mannosyl transferase [Candida albicans]   Goto GenBank  
Score: 74.7  Expect: 7e-13
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.7568  indefinite