genoma.unsam.edu.ar :: tca :: tca-01k17.b1

Sequence

>tca-01k17.b1
CCACGCGTTCGACTATATAGAACTAGTGTGAATCGCTCTGTCCGCCGAAAACAGTGAGAA
GGCATTTCCGTTCTCAGGAGATCGCCTAACCTAAACTATTCTAGACCTTGTTCAGGAAGG
TAGCAACGCACAGATGATCAGGAAGGGCGCGTTCGATGCAACCAATGCATT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q9U3Z7|NHPX_DROME NHP2-LIKE PROTEIN (HOI-POLLOI PROTEIN)   Goto Swissprot  
Score: 98.2  Expect: 1e-20
nr  BLAST report  
gb|AAG23161.1|AF263280_2 (AF263280) NHP2/RS6-like protein [Trypanosoma brucei]   Goto GenBank  
Score: 155  Expect: 4e-37
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.0237  coding