genoma.unsam.edu.ar :: tca :: tca-02a10.b1

Sequence

>tca-02a10.b1
CCACGCGTTCGGATTTTGTACTATATTGTTAAAACTCCTTCTTGCACAATTCCTTTATTC
GGTCAAGTGCTCTAAACCGTAAAGCCGAACACAAAAAGAAAAAAAAATGATGCGCCGTCT
TGGTGTCCGTCCAGACGCTCGACGAGTGGCGACCGCTTATTCCTCTGTTGTTGCTGTGCG
ACACGCCTCAACAGTGGCCATCTCTGTGCAAGGACTTCACTACGTCAGCACCGGCCTCGC
GGCTATTGCGCTTGCCGGTGCGGGCCTTGGTATCGGTACAATCTTTGGCAACTTGCTGGT
CGCGTGTGCGCGTCAGCCCAACCTGAC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAC48310.1| (AF014058) ATPase subunit 9 homolog [Trypanosoma brucei brucei]   Goto GenBank  
Score: 95.9  Expect: 4e-19
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.871  indefinite