genoma.unsam.edu.ar :: tca :: tca-02b1.b1

Sequence

>tca-02b1.b1
CCACTCGTCCGTCATCATGGGTGGGGCTGTTGATGTTCATGGAAATGTATTCCAGCCTAA
CACTGATGGTACAGCAGAATGGAACATTTACTGGGACCCCCCTGCTGCCAAGGTGGTGCT
TAATTGTACCCATATGCGAAACATTCTCTTTTCTTTGGACTCTACAAATAATGTCCCTAT
TTCTTCGCCCTTTGTTCAGCGTTTCGGGGCTCAGAATCAGTATTTACTCTCTCAATTTGT
GGGCAGTGCGTGGGCCATGTGTACACACTGTGAAATATTGCGCCCAGGCGATGGGTACTA
TGCGTGGGATGCTCTCACTGCGGCGTACGTTTTGGATGATGCCATTGCTGACACGGAAGC
CATTGCTATCGATGTGGACGATAAAAA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAG38561.2| (AF311701) IAG-nucleoside hydrolase [Trypanosoma vivax]   Goto GenBank  
Score: 186  Expect: 2e-46
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.2376  coding