genoma.unsam.edu.ar :: tca :: tca-02c16.b1

Sequence

>tca-02c16.b1
GTCGACCCACGCGTCCGCAAGAATTTTAAGAATTCCAAGAATACCAAACCAGCGGAGAAG
CGTACACCCTCCGCATACGCGCAGTTTGTGAAAACGAACATTCAAAAGTTCAGCCAACTG
CCACAGAGGGATCGTATGACGGCTGTGGCTAAATTATGGAAACAACAGCAAGCCAAGTAG
TGTTACTACTTGTTTTCATGATATTTCCTACTTTCTGCAGCG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
pir||JC6092 kinetoplast DNA-associated protein 4 precursor - Crithidia fasciculata prf||2206467C histone H1-like protein [Crithidia fasciculata]   Goto GenBank  
Score: 61.2  Expect: 1e-08
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.7781  indefinite