genoma.unsam.edu.ar :: tca :: tca-02c18.b1

Sequence

>tca-02c18.b1
TCGGCGGCGAGTGCCTCAGCGACGAACCGGTTCTCGCGCAGTACGCCCTGCAGCGTGAAA
GCACCCTTGTAGTAGTCGTCCCCGTTGAGGGCGGTAAGGGCAAGAGGAAGAAGACGAAGA
TCTTCACGAAGCCGAAGAAGCCGATCCACCGCCACAAGCTCGAGAAGATGCGCGCGCTCA
AGTACT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
emb|CAB94028.1| (AL358652) possible ubiquitin fusion protein [Leishmania major]   Goto GenBank  
Score: 104  Expect: 9e-22
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.2791  coding