genoma.unsam.edu.ar :: tca :: tca-02c2.b1

Sequence

>tca-02c2.b1
CCACGCGTCCGGTACTATATTGGAGCTCATTACTTTTTAAATTTGCATGAATACGCATTA
TGTCTTACAAGCCAGCCCACGCTACGGCCCCGACCAACCCGAAGGACTTATTAGACATCA
CTATCGGAGGCAAAGCTGCTGGACGTATTACGTTAGAACTCTTCGCCGATGCTGTACCGA
AGACCGCTGAGAATTTCAGCGCACTTTGCACCGGCTAGAAGGGCTTCCGCTTCGCGAACA
GCGGTTTCCACCGCATCATCCCCAACTTCATGTGCCAAGGTGGTGATTTCACCAACCACA
ACGGCACTGGTGGCAAGTCCATCTACGGTGAGAAGTTTGCCGATGAATCTTTCGCAGGAA
AGGCTGGCAAGCACTT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P30405|CYPM_HUMAN PEPTIDYL-PROLYL CIS-TRANS ISOMERASE, MITOCHONDRIAL PRECURSOR (PPIASE) (ROTAMASE) (CYCLOPHILIN F)   Goto Swissprot  
Score: 173  Expect: 4e-46
nr  BLAST report  
gb|AAB07894.1| (U68268) cyclophilin A [Trypanosoma congolense]   Goto GenBank  
Score: 236  Expect: 1e-65
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.9734  coding