genoma.unsam.edu.ar :: tca :: tca-02e23.b1

Sequence

>tca-02e23.b1
CCACGCGTCCGCCAGGGTGCTTCTCGTTGATGATGTCCTGGCAACAGGCGGAACGGCCCT
CGCCGGGTTGCAGCTTGTTGAAGCAAGTGGTGCCACATCTGTTGAGATGGCGTTCGTTAT
GAACATTACACCACTCTCCGGTGCGAAGAACATACATAATTACAAAGATGGCCGATTCAA
GAATGTCAAAGTTTTCTCACTGGTTGAATCCACGTGCCTTGATGATTCAAATTGTGGTGA
CGTAGTCGACTACGATGGCCCTCGTGTGATCAGTTGCGAATGTGCGCTTAACAAATTATA
AAAATGTTTAGTGCGAATACAATATACTGAATCTTTTTTTTTTTAAGGAAAGAGTGAAAT
TTGGGAAAAAAAA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q9ZLQ9|APT_HELPJ ADENINE PHOSPHORIBOSYLTRANSFERASE (APRT)   Goto Swissprot  
Score: 50.8  Expect: 2e-06
nr  BLAST report  
gb|AAC36208.1| (AF060886) adenine phosphoribosyltransferase [Leishmania tarentolae]   Goto GenBank  
Score: 108  Expect: 8e-23
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.9008  indefinite