genoma.unsam.edu.ar :: tca :: tca-02f15.b1

Sequence

>tca-02f15.b1
CCACGTGTCCGTTCTAAAGCGGCTTCAGATGGCCGAGTGCGTTGATATTACGGACGTAAA
TGAATTGGACAGACTGGGTAGACTACTAGACCTTGACCTTGCAAAGACAAGCGTTACAAC
TGAAGGCATCGAGGGTCTAGCGCACTGTCACTCGTTAACACGCCTAAATATGAGTGACTG
CAGATACGTAACGGATGTCAATCCGTTAGGTGAATTGAGAGCACTGCGTGAGCTGCACTT
GAGTCGGACAGCACTTTCTGACGAGGGAGATCGTCGGGCTATGTCACTGCGTGCAACTTG
AAAACCTGACATTAACCAAGTGCAGTAGTATTACTGACGTGGAGAA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAG59625.1| (AF301417) GU1 [Trypanosoma brucei]   Goto GenBank  
Score: 97.1  Expect: 3e-30
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.8665  indefinite