genoma.unsam.edu.ar :: tca :: tca-02f16.b1

Sequence

>tca-02f16.b1
CGCCTGGGTGCCAACTGCAGTGCCTGCCCAGCGAGCTTGGCGCTGCGCTGAGGGAGCAGT
GGTGCTTCAGAACAAAGTACATGGGAATGATCTCCGCTGATCGCATGCCCGGTTTGGAGT
TCACACGTCAATTGC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
emb|CAC69958.1| (AJ345044) hexokinase [Trypanosoma brucei]   Goto GenBank  
Score: 57.8  Expect: 1e-07
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.9359  indefinite