genoma.unsam.edu.ar :: tca :: tca-02h19.b1

Sequence

>tca-02h19.b1
CCACGCGTCCGCGCCTGACGACGACGCGCAAAAAGGGCAAACTCGCCTTCGCCGTGATCC
GCGACGGGGTCCATTCCATTCAGGCGATGACCGCCGCCAGCGACGACGTGCCGAAGGAGA
TGATTGACTTCATTGGGCAAATTCCGTGCGAGTCCATTGTGGACGTCGAGGCGGAGGTCC
GCGGCACCGCGGAGCCCGTGACGGCGACGTCGCAGCAGGACATTGAGCTGCAGATCCGCC
GCGTGCACATCGTCGCGGAGTCGCAGAGGGTTTTGCCCTTTACACTCGAAGACGCCGCGC
GCCCCGCGGACGCCGATGGGATAAAAGTGAACTTCGACACGCGCCTTGCGTGCCGCTGGC
TTGATATGCGCACACCGGCATCCAATG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q03577|SYD_CAEEL PROBABLE ASPARTYL-TRNA SYNTHETASE (ASPARTATE--TRNA LIGASE) (ASPRS)   Goto Swissprot  
Score: 105  Expect: 8e-23
nr  BLAST report  
gb|AAF58445.1| (AE003820) Aats-asp gene product [Drosophila melanogaster]   Goto GenBank  
Score: 109  Expect: 3e-23
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.2998  coding