genoma.unsam.edu.ar :: tca :: tca-02h9.b1

Sequence

>tca-02h9.b1
CCACGCGTCCGCTCGGCGCAATTAATCCGGCTGATTCGACACCTGGTACAATCCGTGGCG
ACTTTGCCGTTGATGTGGGGCGTAATGTTTGCCACGGCTCTGACTCTGTGGAGAGCGCCA
AACGTGAGATCAGCTTTTGGTTCAAATCAGAGGAGCTAACGAACTGGACGTCACACTCTA
CCGCGCAGATCTACGAATAGTCGTCAGGGTATAAATACCATCATCTGGCAAAGCACCGGG
AAAGTGAAAAACTCTAAATCTCAAAAAGGGAATAAGGAAAAGCATTTTAAATTTATTCAG
CGATGAAAAAGAGGATCAAATATATAGGAAAAAGAAAGAAAGATCTTAATTGATAATAAA
AAAGAAAAAAAAAAAAAAAG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q9UUY8|NDK_NEUCR NUCLEOSIDE DIPHOSPHATE KINASE (NDK) (NDP KINASE)   Goto Swissprot  
Score: 98.6  Expect: 6e-21
nr  BLAST report  
gb|AAD48446.1|AF164200_2 (AF164200) nucleoside diphosphate kinase [Trypanosoma brucei]   Goto GenBank  
Score: 115  Expect: 3e-25
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.6602  noncoding