genoma.unsam.edu.ar :: tca :: tca-02j14.b1

Sequence

>tca-02j14.b1
CCACGCGTTCGGGAAGACTGCCCACAGGCCCCCGAGGACGGTTGCTTCATATATGGCCTT
TTTCTCGAGGGCGCTGGATGGGACCCCGCCGAAGGCGTTCTCTGGGAGAGCAAACCGAAT
GAACTGTTTATAAAGTTCCTTGTCCTGCACTTGGTTCCGCGCCGCGAGCAGGACCTACCC
GACACCCCTATTTA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q9NYC9|DYH9_HUMAN CILIARY DYNEIN HEAVY CHAIN (AXONEMAL DYNEIN HEAVY CHAIN) (DYNEIN HEAVY CHAIN 9)   Goto Swissprot  
Score: 55.5  Expect: 9e-08
nr  BLAST report  
gb|AAF53626.1| (AE003655) Dhc36C gene product [Drosophila melanogaster]   Goto GenBank  
Score: 95.9  Expect: 4e-19
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1216  coding