genoma.unsam.edu.ar :: tca :: tca-02j2.b1

Sequence

>tca-02j2.b1
CCACGCGTCCGATCACTGCACTGGTGACAGTGTTCCATTTATATTACATTCTCTGCTACG
AAAACCATCAGTGGTGGTGGTTTGCTTTTATCATCCCTGGTGGCCTCGGATTGCATCTCT
TTCTTTACTCTTTTTACTTTTATGCGACACAGCTTTCTATCACTTCATTTGCTTCATCGC
TGCTGTACTTCTTGTATATGAGCCTCGTTTCGTACGCATACGGAATTGCCTCCGGATGCA
TTGGACTGACCTCTGGTATTCTGTTTGTGCGCAAAATATACGGTAGCATAAAAGTTGACT
GAGGGGGACTTTAGGTAAATGTCTGGATCACCCGCCAATTGAT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q92544|T9S4_HUMAN TRANSMEMBRANE 9 SUPERFAMILY PROTEIN MEMBER 4   Goto Swissprot  
Score: 86.3  Expect: 4e-17
nr  BLAST report  
ref|NP_187991.1| multispanning membrane protein, putative [Arabidopsis thaliana] dbj|BAB01926.1| (AP001307) multispanning membrane protein-like [Arabidopsis thaliana]   Goto GenBank  
Score: 97.4  Expect: 1e-19
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.5086  noncoding