genoma.unsam.edu.ar :: tca :: tca-02k8.b1

Sequence

>tca-02k8.b1
CCACGCGTCCGCCTCTGGCCGTTCCCGAAGGTCGCGTCCGTGCTGGAGCCGACGCAGCGG
CTGCCGGCGTGGATCCCTGTCGTGCGGAACGAGGAACTCCTGCGCGGCATTGAGGACAGC
AGAAGCACGAGGCACGTCGAGTTTGATATTAGCGGCACAATCATATCATACCAGGGTGGG
GATCACCTCGGCATTCTCCCGTGCAACACGGATGCCACGGTCAACGCGTATTTGCGGATC
CTCGGGATTAGTGAAGAGGAGGCACAGCAGGTCTTCTCACTACAAGACAGAAAGACTGGA
AAAAGTGTCTTTCCGGCACGTGTTTCGGTGCGCACAGCGTTTAAGTGGTACTTAGACCTT
GATGGCCCACCGAAGAAGTCGATACT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P16435|NCPR_HUMAN NADPH-CYTOCHROME P450 REDUCTASE (CPR) (P450R)   Goto Swissprot  
Score: 82.0  Expect: 1e-15
nr  BLAST report  
dbj|BAB18572.1| (AB051763) NADPH-cytochrome P-450 reductase [Homo sapiens]   Goto GenBank  
Score: 82.8  Expect: 4e-15
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1463  coding