genoma.unsam.edu.ar :: tca :: tca-02m1.b1

Sequence

>tca-02m1.b1
CCACGCGTCCGCGCTCTTGTTGAATGTTGTAGTGATGAGGATGCTGTTACGCAAAAATTT
GCTGCATTTGCAGCAGGCAATGCTGCCTTTCATAATGAGGTTCTTTACGAAAGCCTTATA
CCAGCAATCCCAGCAATAGTTAAACTTCTTTCAAGTGCTGATGAAAAAACACGTCAAAAT
GCTGCTGGTGCT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
emb|CAC07966.1| (AJ293290) putative mitogen-activated protein kinase kinase 2 [Leishmania mexicana]   Goto GenBank  
Score: 97.1  Expect: 2e-24
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.0883  coding