genoma.unsam.edu.ar :: tca :: tca-02n6.b1

Sequence

>tca-02n6.b1
CCACGCGTCCGTGAGAAGTTCATCGTGAGTAATACAATAAAGATCATGGCGGCCCTTACC
GATGAACAAATCCGTGAGGCATTCAATCTTTTTGACGCCGATGGTTCTGGCGCGATTGAC
GCAGAAGAAATGGCGCTGGCGATGAAGGGTCTCGGATTCGGCGACCTTCCCCGCGATGAT
GTGGAGCGCATGATTCAATCCATGAATACAGACTCAAACGGACTCATTGAATATGGTGAG
TTCGAACGTGTGGTAAAGTCCCGCATGGCGC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q06827|CATR_SCHDU CALTRACTIN (CENTRIN)   Goto Swissprot  
Score: 91.3  Expect: 8e-24
nr  BLAST report  
gb|AAL01153.1|AF406767_1 (AF406767) centrin [Leishmania donovani]   Goto GenBank  
Score: 169  Expect: 4e-53
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1497  coding