genoma.unsam.edu.ar :: tca :: tca-02o20.b1

Sequence

>tca-02o20.b1
CCCACGCGTCCGAGTTCTTCCGTATTAAGGAAGATCCAACCCTCCTGCGCTTCGTGTACT
CGCGCAAGGATGATCTCAATGAGGGGAATCCGGTGCGTTTTACGGGACTTGTGCCGTACC
ATGAGGGTCGCTACACTGGAACAGGCGATGTCTTCGCGGCCACACTGCTTGCCTTTGCTC
ATGAGCTCCCGTTGGAAGCGGCAATCGGAAAGACAATGGGCGTCCTCCAGGATCTCATCA
TCGCCACACGCCACGCTGGTGGTGATGAAAAGAGTTCTCTTAATTGTCGCGAATTGCGCG
TGACCAAATCACCTAACGCACTG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAC61803.1| (U96712) pyridoxine/pyridoxal/pyridoxamine kinase [Trypanosoma brucei]   Goto GenBank  
Score: 135  Expect: 5e-31
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.167  coding