genoma.unsam.edu.ar :: tca :: tca-03a24.b1

Sequence

>tca-03a24.b1
CCACGCGTCCGCGCGGACATATCGTGAATATCAGGCCCTAGTGGACTCTTGGCGGGCCCG
CGAGTTTGTCAACCGCGTTCAGCAACTGCGTAAAAAGGCGAAGCTCATCGTCACAGATTT
GGTGGACATCTACTTTGAAGCCGAGGATGCTGAGCTCACCAAATCTATTCTTAATTGCAG
TGAGCAAATTAATAAGACGATAAAAGGCAAATGGGTTCTGATGAGTGAGCTCCCAACCGA
TGCGAAACTCATCGCAGAAGAAGAGAATGCCATTTCTGGTGTTGGTATTAAGATCATTCT
TACCGAAGCGAGTTAGATTAGGGAGACATGTTTAATTTCTAGTATACTTCTAGGTATTTT
ATCTAGATACAAGAGAGAAGCATGACAGTGATCTTT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P41252|SYI_HUMAN ISOLEUCYL-TRNA SYNTHETASE, CYTOPLASMIC (ISOLEUCINE--TRNA LIGASE) (ILERS) (IRS)   Goto Swissprot  
Score: 56.6  Expect: 4e-08
nr  BLAST report  
gb|AAG49529.1|AF326935_1 (AF326935) isoleucine tRNA synthetase [Leishmania donovani]   Goto GenBank  
Score: 130  Expect: 2e-29
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.9723  coding