genoma.unsam.edu.ar :: tca :: tca-03b17.b1

Sequence

>tca-03b17.b1
CAAAGATTGAAATTGATGACGTGCGCGACGACCCGGAGCTCGGGACGATGACGCGCGTTG
CCGTGGACGGAAAGCTGCTCCTGGTCTCGCAATACCCACAGCTCGGCCCCCGGAAAGTGG
ACCCCAACGACCTGAGTTCACAGTTCGACTCGGACCGCCGCATTTCTGTGCGGATGCGGG
ACATTGATCTTGCCTATCTCGTGAGCGTTAGTACGGGCCGCGTGCTC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAC47460.1| (U61382) gBP21 precursor [Trypanosoma brucei]   Goto GenBank  
Score: 155  Expect: 4e-37
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.2377  coding