genoma.unsam.edu.ar :: tca :: tca-03c14.b1

Sequence

>tca-03c14.b1
CCACGCGTCCGGAGAAAAATAAAAAAACAAGTCGATTTTCAGTTTTTTAGTAGAACGAGA
ATGGGACAGAGCAAAACAAAGTTGCACATTATCATCTGTGGTCTTGATAACAGTGGAAAA
ACGACCATAATTAATGAATTGAAGCCAGCACGTCACCGTAGTGAACACTTATCGGCAACG
GTTGGCTATAATGTGGAAACCTTCGAGAAGGACAAGGCAAAATTTACT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|O88848|ARL6_MOUSE ADP-RIBOSYLATION FACTOR-LIKE PROTEIN 6   Goto Swissprot  
Score: 84.7  Expect: 4e-22
nr  BLAST report  
ref|NP_062639.1| ADP-ribosylation-like 6; ADP-ribosylation-like factor homolog ARL6 [Mus musculus] sp|O88848|ARL6_MOUSE ADP-RIBOSYLATION FACTOR-LIKE PROTEIN 6 gb|AAC62194.1| (AF031903) ADP-ribosylation-like factor homolog ARL6 [Mus musculus] dbj|BAB22990.1| (AK003778) putative [Mus musculus]   Goto GenBank  
Score: 84.7  Expect: 3e-21
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.701  noncoding