genoma.unsam.edu.ar :: tca :: tca-03f17.b1

Sequence

>tca-03f17.b1
CCACGCGTCCGTGCTTCGCCTTGCGTCAGGAAGGACACCTCTTGCTGTCTTGTCATTGGC
TCGCCGTGCCACCTTCGGTAGCGCGCAGAGTCTCCCAAAGTTTGAAATTCATGACGTGCG
CGACGACCCGGAGCTCGGGACGATGACGCGCGTTGCCGTGGACGGAAAGCTGCTCCTGGT
CTCGCAATACCCACAGCTCGGCCCCCGGAAAGTGGACCCCAACGACCTGAGTCCACAGTT
CGACTCGGACCGCCGCATTTCGGTGCGGATGCGGCACATTGATCTTGCCTATCTCGTGAG
CGTTTGTACGGGCCGCGTGCTCAATCATCGTATGGAGAACCGCGCATACTCGCTTAACTT
TGAGAAAACAGCTGAGGGATATTGTCT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAC47460.1| (U61382) gBP21 precursor [Trypanosoma brucei]   Goto GenBank  
Score: 262  Expect: 3e-69
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1223  coding