genoma.unsam.edu.ar :: tca :: tca-03g1.b1

Sequence

>tca-03g1.b1
CCACGCGTCCGGAGAAGGCATTTCCGCTCTCAGGAGATCGTCTAACCTAAACTATTATCG
ACCTTGTTCAGGATGGTAGCAACGCAAAGATGATCAAGAAGGGCGCGAACGAGGCAACCA
AGGCATTGAACCGCGGCATAGCGGACCTAATCGTTTTGGCGGGAGATACAAATCCTATTG
AAATTCTACTTCATCTTCCTCTTCTTTGTGAAGACAAGAATGTGCCTTATGTCTTTGTGC
CATCGAAAACAGCACTTGGTCGCGCGGCGCATGTCTCTCGCAATGTAGCTGCTCTTGCTA
TACTACAGTCTGAGAACAGGCCCATATCTTCGAAGGT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q21568|NHPX_CAEEL NHP2/L7AE FAMILY PROTEIN YEL026W HOMOLOG   Goto Swissprot  
Score: 142  Expect: 5e-34
nr  BLAST report  
gb|AAG23161.1|AF263280_2 (AF263280) NHP2/RS6-like protein [Trypanosoma brucei]   Goto GenBank  
Score: 207  Expect: 8e-53
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1334  coding