genoma.unsam.edu.ar :: tca :: tca-03h13.b1

Sequence

>tca-03h13.b1
CCACGCGTCCGCGCGCATCCACTTCGTGCTCACGAGCTACGCCCCGGTGATCTCAGCGGA
GAAGGCGTACCACGAGCAGCTGTCCGTGTCGGAGATCTCAAACGCGGTCTTCGAGCCGGC
GTCGATGATGACCAAGTGCGACCCGCGCCACGGCAAGTACATGGCGTGCTGCCTCATGTA
CCGCGGCGACGTGGTGCCGAAGGATGTGAACGCCGCGGTCGCGACGATCAAGAC


BLAST summary (best hit)

trypHTG  BLAST report  
emb|AL359782.1|TBBCHR1A Trypanosoma brucei chromosome 1 strain TREU927, *** SEQUENCING IN PROGRESS ***, in ordered pieces   Goto GenBank  
Score: 315  Expect: 1e-85
sp  BLAST report  
sp|P04106|TBA_TRYBR TUBULIN ALPHA CHAIN   Goto Swissprot  
Score: 276  Expect: 2e-74
nr  BLAST report  
sp|P04106|TBA_TRYBR TUBULIN ALPHA CHAIN pir||UBUTA tubulin alpha chain - Trypanosoma brucei rhodesiense gb|AAA30262.1| (K02836) alpha tubulin [Trypanosoma brucei] emb|CAB95489.1| (AL359782) tubulin alpha chain. [Trypanosoma brucei] emb|CAB95491.1| (AL359782) tubulin alpha chain. [Trypanosoma brucei] emb|CAB95493.1| (AL359782) tubulin alpha chain. [Trypanosoma brucei] emb|CAB95495.1| (AL359782) tubulin alpha chain. [Trypanosoma brucei]   Goto GenBank  
Score: 276  Expect: 1e-73
trypEST  BLAST report  
gb|AA114360.1|AA114360 T3723 MVAT4 bloodstream form of serodeme WRATat1.1 Trypanosoma brucei rhodesiense cDNA 5' similar to gi|135440|sp|P04106|TBA_TRYBR TUBULIN ALPHA CHAIN, mRNA sequence   Goto GenBank  
Score: 252  Expect: 4e-67

Testcode evaluation

Score  Evaluation  
1.298  coding