genoma.unsam.edu.ar :: tca :: tca-03h4.b1

Sequence

>tca-03h4.b1
CCACGCGATCGAGGAGGAGGAGCAATATAACAGAAAGTTGGAGGAAGAAACACTTAAAGA
TTTTCTTATGACTGCCACCCTTTCTTTTGCAGGAGAAATAAACCCTCTAACATTGCAGAA
ATATGCAAAA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P12865|BS2_TRYBB BLOODSTREAM-SPECIFIC PROTEIN 2 PRECURSOR   Goto Swissprot  
Score: 52.8  Expect: 6e-07
nr  BLAST report  
sp|P12865|BS2_TRYBB BLOODSTREAM-SPECIFIC PROTEIN 2 PRECURSOR pir||A32820 protein disulfide-isomerase homolog precursor - Trypanosoma brucei gb|AAA30168.1| (J02865) disulphide isomerase-like protein [Trypanosoma brucei]   Goto GenBank  
Score: 52.8  Expect: 4e-06
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.8571  indefinite