genoma.unsam.edu.ar :: tca :: tca-03h6.b1

Sequence

>tca-03h6.b1
CCACGCGTTCGGTCACCATGGGTGAGCGAACTCCTACGATTAATTGGTTTGTGTGCCTTG
GAGCCTGGTGCGGCGACGCTTGCTATGGACACTTTGCGAGCGCTGTGTTGCAGTTCATTG
TGCGAAGTCGCTTGCGGAGGCATTATAATATTGCTGGGTCTGACTGCGGTGATGGAGTTC
TTGTGTGTTGCTGTGCTAACTGTGCACTTCAGCAAACGCTGCTGGAGATGACTCACTGTG
GTTCGTTTCCTGGCGCATGCTGCTATGATGTCCCCACCCAAAGGATGATGACGTAGTCGC
TCAAGTACATATATGGCAATTAAATTGCTTGCTTTAAGGAACGCTGCACGGACTTTAAGT
ATGCGTTCGAGATA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
emb|CAB59203.1| (AJ250400) ama1 protein [Leishmania major]   Goto GenBank  
Score: 51.6  Expect: 9e-06
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.8129  indefinite