genoma.unsam.edu.ar :: tca :: tca-03h9.b1

Sequence

>tca-03h9.b1
CCACGCGTTTAGAAAATGACAATTCAGGGCAACGGAAGCAACACACGTACGTTCATTCAC
GCCGATGATGTGGCCCGTGCTTTTATTTTGATCGTTGATAAAGGTATTATTGGCGATGTC
TACAACATTGGATCACAGGATGAGAAGAGTGTGATGGACATCGCCCGCCTCACTATCAAG
TACCT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P37777|RFBB_SHIFL DTDP-GLUCOSE 4,6-DEHYDRATASE   Goto Swissprot  
Score: 65.9  Expect: 7e-11
nr  BLAST report  
ref|NP_055120.1| dTDP-D-glucose 4,6-dehydratase [Homo sapiens] ref|XP_007208.2| dTDP-D-glucose 4,6-dehydratase [Homo sapiens] ref|XP_036443.1| dTDP-D-glucose 4,6-dehydratase [Homo sapiens] emb|CAA06840.1| (AJ006068) dTDP-D-glucose 4,6-dehydratase [Homo sapiens] gb|AAD50061.1|AF048686_1 (AF048686) dTDP-glucose 4,6-dehydratase like protein [Homo sapiens]   Goto GenBank  
Score: 79.0  Expect: 5e-14
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.2365  coding