genoma.unsam.edu.ar :: tca :: tca-03j7.b1

Sequence

>tca-03j7.b1
TTCCCGGGTCGACCCACGCACCCACGCGTTTGGTGCTATATTGGTGCTCATTACTTTCTA
AATTTACAAGAATTTGCATTATGTCTTACAAGCCGGCCCACGCTACGGTCCCGACCAACC
CCAAGGTCTTCTTTGACATCACTATCGGAGGCAAAGCTGCTGGACGTATTACGTTCGAAC
TCTTCGCCGATGCTGTCCCGAAGACCGCTGAGAATTTCCGTGCACTTTGCACGGGCGAGA
AGGGCTTCGGCTTCGCGAACAGCGGTTTCCACCGCATCATCCCCAACTTCATGTGCCAAG
GTGGTGATTTCACCAACCACAACGGCACTGGTGGCAAGTCCATCTACGGTGAGAAGTTTG
CCGATGAATCTTTCGCAGGAAAGGCTGGCAAGCACTTTGGTTCTGGCACACTCTCAATGG
CTAACGCCGG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P10111|CYPH_RAT PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (PPIASE) (ROTAMASE) (CYCLOPHILIN A) (CYCLOSPORIN A-BINDING PROTEIN) (P31)   Goto Swissprot  
Score: 224  Expect: 1e-58
nr  BLAST report  
gb|AAF05985.1|AF191832_1 (AF191832) cyclophilin A [Trypanosoma cruzi]   Goto GenBank  
Score: 295  Expect: 4e-79
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.9659  coding