genoma.unsam.edu.ar :: tca :: tca-03l17.b1

Sequence

>tca-03l17.b1
CCACGCGTCGAGAATTTTGACTTTTCAGGGCAACGGAAGCAACACACGTACGTTCATTCA
CGCCGATGATGTGGCCCGTGCTTTTATTTTGATCGTTGATAAAGGTATTATTGGCGATGT
CTACAACATTGGATCACAGGATGAGAAGAGTGTGATGGACATCGCCCGCCTCACTATCAA
GTACCTTCGACCATTCAAGTCTGAAGAAAAGGAACTTCGCGATCCAAGTGAAAGTGAGGT
AAGAAGTATGGTAAAATTTGTAAAGGATAGAGACTTCAATG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P55462|RFBB_RHISN PROBABLE DTDP-GLUCOSE 4,6-DEHYDRATASE   Goto Swissprot  
Score: 60.5  Expect: 3e-09
nr  BLAST report  
ref|NP_175755.1| dTDP-D-glucose 4,6-dehydratase, putative [Arabidopsis thaliana] gb|AAF78439.1|AC018748_18 (AC018748) Contains similarity to dTPD-D-glucose-4,6-dehydratase from Sphingomonas sp.S88 gb|U51197 and contains a NAD dependent epimerase/dehydratase PF|01370 domain. [Arabidopsis thaliana] gb|AAG51981.1|AC024260_19 (AC024260) dTDP-D-glucose 4,6-dehydratase, putative; 102946-105028 [Arabidopsis thaliana]   Goto GenBank  
Score: 82.4  Expect: 4e-15
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1816  coding