genoma.unsam.edu.ar :: tca :: tca-03l20.b1

Sequence

>tca-03l20.b1
TCCGGAGTTCCCGGGTCGACCCACGCGTCCGGCGGCTCAGTTTTATGAACGCGCCATCAA
GCTTTGTTCGGACAAAAAAAGTAAAGAAATGGCAAATTACTATGCAAACCGGGCGTCATG
TTTTCAGCAAACGCACAGCTTTCATGAAGTGATCAGTGACTGCAATGAAGCACTTGCAAT
TGACCCAACTCACCTCAAGGCGCTTCTTCGTCGCGCTACTGCATATGAAGCCCTAGAGAA
GTGGCAAAAGGCTCTTGATGATTACGGTCAGGTCAATCGCCTTTCTCCAGGGTTGCCTCT
CGTATCACAGGGTGTGCTTCGTTGTCAGCGCGCATTGAAGGGATAGACATCAACGTACGC
GCACGCATACACTCATACACACTG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|O94826|OM70_HUMAN MITOCHONDRIAL PRECURSOR PROTEINS IMPORT RECEPTOR (TRANSLOCASE OF OUTER MEMBRANE TOM70)   Goto Swissprot  
Score: 70.5  Expect: 3e-12
nr  BLAST report  
pir||C48583 stress-inducible protein STI1 homolog - Leishmania donovani gb|AAK14903.1| (L06119) stress-inducible protein [Leishmania donovani]   Goto GenBank  
Score: 115  Expect: 4e-25
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.0758  coding