genoma.unsam.edu.ar :: tca :: tca-03o4.b1

Sequence

>tca-03o4.b1
CCACGCGTCCGCTATATTGTATGTAAAAGACCATTCAGGCGTAGGAACAACTAAAGAAGA
AAACAACAGTCTATAAGCAAAAGAGGTACAAACAAGAGCGATCTAACGATGTTCCGCGTT
TCTCTTGCAAATCGGTATCTTGTGCCAAGTGCCGCCCTTCTCAACAAAGGAAAGGTTGTT
TCATGGATGTCTGGACGTGGATTCGGGTTTGTTGAGGACGATGCTGACAAGAAGCAGCAC
TTTGTGCATTTTTCAGCCCTTCAGACAGAAACGGGTGGATTTCGCTCACTCACTGTTGGT
CAAGATGTGGAGTTCGAAGTAGCCTCGCAAGACGGCCGAACGCGTGCCGAGAACGTAACT
TCTCCTGGCGGAGCGAAACTGCCATCTGGCCCGCGCCCACC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P27484|GRP2_NICSY GLYCINE-RICH CELL WALL STRUCTURAL PROTEIN 2 PRECURSOR   Goto Swissprot  
Score: 59.7  Expect: 5e-09
nr  BLAST report  
gb|AAD29082.1| (AF042492) RNA binding protein precursor [Trypanosoma brucei]   Goto GenBank  
Score: 159  Expect: 3e-38
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.793  indefinite