genoma.unsam.edu.ar :: tca :: tca-03p4.b1

Sequence

>tca-03p4.b1
CCACGCGTCCGAATGTAGTTTTTTGGAATTTTGGGGGGACCATTTTTGATTTCTTTTTCC
AGAAAACAGATGAAGTTTTTCCGGGAATTTCCAACGTTTTTATTTTGGGGGGGAACGGAG
CGCGAGGAAGGCCCCATTTGTATTGCATAGATTTTTTTTTGCGTTTTTTGTTGCTTGTAT
TGGATTTTATGTGTGGGCACCGGCTCTATTTTTTTGTATGAATCTTTTATTTTGAGTTTA
CCTTTGTTTCGTTGTTATTTAATGGGGTATGCATTGGCCCATTTTTATTTCCGATGCCAT
TAC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P30826|NUIM_TRYBB NADH-UBIQUINONE OXIDOREDUCTASE SUBUNIT 8 (MAXICIRCLE IRON-SULFUR PROTEIN 1)   Goto Swissprot  
Score: 52.8  Expect: 6e-07
nr  BLAST report  
sp|P30826|NUIM_TRYBB NADH-UBIQUINONE OXIDOREDUCTASE SUBUNIT 8 (MAXICIRCLE IRON-SULFUR PROTEIN 1) pir||A44385 iron-sulfur protein - Trypanosoma brucei mitochondrion gb|AAA91499.1| (M63820) NADH dehydrogenase subunit 8 [Trypanosoma brucei]   Goto GenBank  
Score: 52.8  Expect: 4e-06
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.4529  noncoding