genoma.unsam.edu.ar :: tca :: tca-03p9.b1

Sequence

>tca-03p9.b1
TCCCGGGTCGACCCACGCGATCCACGCGTTCGATTCTTATAAACTCAGACAATATTTTGA
AACTTGCTGATTTTGGATTGGCCCGCGCGTTTCAGATTCCATTGCGCACTTATACTCACG
AAGTTGTCACACTTTGGTATCGAGCGCCTGAAATATTGTTGGGTGAAAAGCATTACACAC
CAGCGGTCGATATTTGGAGTGTTGGCTGCATTTTTGCGGAATTGACTAGGGGAAAGGTAT
TATTTCGCGGTGACAGTGAAATCGGTCAACTTTTTGAGATTTTTCAAACACTTGGTACTC
CTGTAGACATTGAAGGATCTTGGCTTGGTGTGTCGTCACTTCCCGATTATCGTGATGTTT
TTCCTCGTTGGCCTGGAAAATCACTTGCACAAGTACTTCC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P54666|CC23_TRYBB CELL DIVISION CONTROL PROTEIN 2 HOMOLOG 3   Goto Swissprot  
Score: 251  Expect: 3e-69
nr  BLAST report  
gb|AAC48317.1| (U69958) cdc2-related protein kinase 3 [Trypanosoma cruzi]   Goto GenBank  
Score: 254  Expect: 5e-69
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.9308  indefinite