genoma.unsam.edu.ar :: tca :: tca-04b23.b1

Sequence

>tca-04b23.b1
ACGCGTCCGACGTTCGCGAAAGATATATCGTTTTATCGAAATTCCAGAGAATGGTTTGGT
CTGCGAGAGTCTTTGGTCCGATCCACAAGAGATGAATGGGCGTGCGGTGAGCAAGCGTGG
TGTGGATTGCCCGTCCTTCGGGCCCGACATCACAGCCAAGTTTCTTAATCATAATAATCT
CAAATTAGTGGTACGGTCGCACGAAGTAAAAGAAGAAGGATATGTGGTCGAGCACAATGG
CAAGTGTATTACCGTTTTTAGCGCGCCAAACTACTGCGATCAGATGGGGAACAAGGGTGC
TTTTATTCGTTTTACTGGTGGTGTGATGAAGCCGATATTTACAACTTTCGAGCATGTGCC
TCACCCTGGAAAGCGTCCCATGTATTACGCATCGGG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P53041|PPP5_HUMAN SERINE/THREONINE PROTEIN PHOSPHATASE 5 (PP5) (PROTEIN PHOSPHATASE T) (PP-T) (PPT)   Goto Swissprot  
Score: 161  Expect: 1e-39
nr  BLAST report  
gb|AAG40278.1| (AF305085) serine/threonine protein phosphatase type 5 [Trypanosoma brucei]   Goto GenBank  
Score: 222  Expect: 4e-57
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.8745  indefinite