genoma.unsam.edu.ar :: tca :: tca-04f7.b1

Sequence

>tca-04f7.b1
CCGGGTCGACCCACGCGTCCGGAGCGGAAAATCTTGGCCCCAATACATTCAATGGCCATT
ATGGGCCGGTGTACTCAGTGCATCGCAACCCATACTTCTCAAAGTACTTCCTTTCCGTTG
GGGACTGGACGGCACGGTTATGGTTTGAGGACTTCAAGTTTACTCCGCTGTTTAGCACAT
TTTACCATAAGGCCTACTTGACGAGTGGATGCTGGCACACGGTGCGTCCTGGTGTCTTCT
TCACAACTCGTATGGACGGTTATCTTGATGTTTGGGACCTCATGCTCCGACAGTCGTCTT
CATCGCTGAGCATTCACATTTCGGACTACGCGGTACATACAGTGAAGCCAACAGTAGAGG
GGCACCACGTTGCAGGTGGCGGCATTGACGGGAATGTGACACTTCTGGAGCTCTCTCCGT
CG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q16960|DYI3_ANTCR DYNEIN INTERMEDIATE CHAIN 3, CILIARY   Goto Swissprot  
Score: 151  Expect: 1e-36
nr  BLAST report  
sp|Q16960|DYI3_ANTCR DYNEIN INTERMEDIATE CHAIN 3, CILIARY dbj|BAA06013.1| (D28863) dynein intermediate chain 3 [Anthocidaris crassispina]   Goto GenBank  
Score: 151  Expect: 8e-36
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.7455  indefinite