genoma.unsam.edu.ar :: tca :: tca-04h7.b1

Sequence

>tca-04h7.b1
CCACGCGCTCCGGAATACTATTGGAGTCTTGATACCGATTCGTTTCTCACTAAGCCTGTG
CCTTGTGACATATTTCAACTGATGAGGGCAAACGAATGTGTGTATGGATATCGTTGGATT
GAACCAGACCATAAAGATGTTGTCGAGAAGTTGTGGCCCACCTTTTTGCGTTGGGCATTT
GGTGTACTTTCTCGTGGAGAGATACAGTACATTAGGGATTTCGCTACCAACAGTGGTACA
TATTCTCGCATAATGTACTACAACAACTTTGAGCTTGGCAAGATATCGGTTAAGCGGCAT
CCGTTATATCAGTCGATGTTTCGTGCCCTGGATGAAGAA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P27809|KRE2_YEAST GLYCOLIPID 2-ALPHA-MANNOSYLTRANSFERASE (ALPHA-1,2-MANNOSYLTRANSFERASE)   Goto Swissprot  
Score: 53.1  Expect: 4e-07
nr  BLAST report  
emb|CAA82879.1| (Z29988) Mnt1 protein [Saccharomyces cerevisiae]   Goto GenBank  
Score: 53.1  Expect: 3e-06
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.7778  indefinite