genoma.unsam.edu.ar :: tca :: tca-04i10.b1

Sequence

>tca-04i10.b1
CCACGCGTCCTGTTTCTGTACTATATTGTTTTAAGGCGTTTATTAGAATTTTTACTGGCG
CAATGTCTCGTGTGCCGATCAGTGAAGAGCAGGCCCAGCAGATGATGATGAAGCAGCAAG
CACAGCAAGAGCGGGTTGAAGCAATGCAGGAACAGAAGGAGAGCATGATGCGTGCGTTTG
TCAGCGCTGAGGGTCGGGAGAGACTGAAGCGTATTGAGCAGGTGAAAGAGGAACGTGCGC
ATGCTGTAGAGTCTTACATCATTCAAGCTGTTCGCCAGGGGAAATTGCAGCCCCCCGTAT
CAGACGAAACTGTAAGGGAAATTCTGTCGCAGGTATCAGCACAGGGCACTGAGGCGAAGA
GCAGCATTACATTCGCTCGCAAACGTATGGACGATGA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P56812|PCD5_MOUSE PROGRAMED CELL DEATH PROTEIN 5 (TFAR19 PROTEIN) (TF-1 CELL APOPTOSIS RELATED GENE-19 PROTEIN)   Goto Swissprot  
Score: 57.8  Expect: 2e-08
nr  BLAST report  
gb|AAK40684.1| (AE006669) Apoptosis-related Tfar19 related protein (pdcd5) [Sulfolobus solfataricus]   Goto GenBank  
Score: 58.5  Expect: 7e-08
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.2489  coding