genoma.unsam.edu.ar :: tca :: tca-04i3.b1

Sequence

>tca-04i3.b1
CCACGCGTCCGGTTTCTGTACTATATTGGTGCTCATTACTTTTTAAATTTACAAGAATTT
GCATTATGTCTTACAAGCCGGCCCACGCTACGGTCCCGACCAACCCCAAGGTCTTCTTTG
ACATCACTATCGGAGGCAAAGCTGCTGGACGTATTACGTTCGAACTCTTCGCCGATGCTG
TCCCGAAGACCGCTGAGAATTTCCGTGCACTTTGCACGGGCGAGAAGGGCTTCGGCTTCG
CGAACAGCGGTTTCCACCGCATCATCTCCAACTTCATGTGCCAAGGTGGTGATTTCACCA
ACCACAACGGCACTGGTGGCAAATCCATCTACGGTGAGAAGTTTGCCGATGAATCTTTCG
CAGGAAAGGCTGGCAAGC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P10111|CYPH_RAT PEPTIDYL-PROLYL CIS-TRANS ISOMERASE A (PPIASE) (ROTAMASE) (CYCLOPHILIN A) (CYCLOSPORIN A-BINDING PROTEIN) (P31)   Goto Swissprot  
Score: 198  Expect: 7e-51
nr  BLAST report  
gb|AAB07894.1| (U68268) cyclophilin A [Trypanosoma congolense]   Goto GenBank  
Score: 263  Expect: 1e-69
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.9647  coding