genoma.unsam.edu.ar :: tca :: tca-04j23.b1

Sequence

>tca-04j23.b1
CCGGAATTCCCGGGTCCACCCACGCGTCCGGGAGTATTCATCATAGAAGCAGTCTGATAC
CAAAACTACTACTTCTACCACTACAAAAAAAATATGTTTGCCAAGCGGTCAATGGGACGA
AAACTGCTCTACGCAGCGGGTCTAACGGGTCTACTTGGTTTGGGTGGAGTATACACCACA
TATCAGCGTCGACTCAAAGAAAACCGCAGTTGCTCTGCTGAAGATTTCAACGCCAAGCAA
AACCAGGAGGATCTTCAGTGGGCTCTTACCCACATGAAAGATAAGAAGGAGCATCCACAA
ATTTTATTTTATCGATACTCTACCTGTCCTTTTTGTGGTACTAC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAF40169.2|AF223386_1 (AF223386) putative glutathione-s-transferase/glutaredoxin [Trypanosoma cruzi]   Goto GenBank  
Score: 142  Expect: 5e-33
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.5958  noncoding