genoma.unsam.edu.ar :: tca :: tca-04p17.b1

Sequence

>tca-04p17.b1
GATTGTGTGAGTGCTTTAACAAAAACAACAAAAAAGAAGTATAATAAGTGCGCATCAATC
ATAAATACCATGAAGGCATTTGAAAGTAATTACAAAATGTCTCACACCCTTGAAACGCGG
CAGAGGGATGCAGCAAAGGTTCGTGAGCGATATCCTGACCGTGTGCCATTGATTTGCGAA
AAAGCAGATGATTCTGGCATTAGTGACCTGGACAAAATCAAGTTTCTTGTGCCGTCTGAT
CTTACGATTGGTCGGTTTATCATGGTGCTCCGCAAACGTGTCCAATTGGAGCCA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P87068|SYRP_LACBI SYMBIOSIS-RELATED PROTEIN   Goto Swissprot  
Score: 102  Expect: 8e-31
nr  BLAST report  
ref|NP_178631.1| putative microtubule-associated protein [Arabidopsis thaliana] gb|AAD24645.1|AC006220_1 (AC006220) putative microtubule-associated protein [Arabidopsis thaliana]   Goto GenBank  
Score: 103  Expect: 4e-31
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.0138  coding