genoma.unsam.edu.ar :: tca :: tca-05b16.b1

Sequence

>tca-05b16.b1
CCACGCGTCCGCGGACGCGTGGGCATTGGAAAGACGCCTACCGCTGCGTAGATGCAAACA
TCAGAGGTGGGGTGAAGGTCCCTAACGGCCTCATGTTCAAGGGCGCCGGTGCTGGCGCCA
TGTGGCCGGTTATGAAGCAAGGGCAGAACCGGCCTTACCATTTTGTGAACCACGAGTTCA
CTCTGGCAGCAACCGTGACCATTCATGAATGCACATCGAATACTCCTTCTTCAATACTGG
GTTTGGTGCTAGCTAGTATTAAGCCCAGAAGATTTATGTATTTGTCTTGCACAAAAGACG
GCAGACTCCACTTTAATGCGGGCCTGTACTCGCGCAATTCAGGTCTATACTTTAATGTAA
ATGAGACAT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P23253|TCNA_TRYCR SIALIDASE (NEURAMINIDASE) (NA) (MAJOR SURFACE ANTIGEN)   Goto Swissprot  
Score: 85.1  Expect: 1e-16
nr  BLAST report  
gb|AAC95493.1| (U83180) sialidase precursor [Trypanosoma rangeli]   Goto GenBank  
Score: 104  Expect: 1e-21
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.7425  indefinite