genoma.unsam.edu.ar :: tca :: tca-05c14.b1

Sequence

>tca-05c14.b1
CCACGCGTCCGCCACGCTCCAGAACAATCTGCCCATAGGAGCGCCGTTTCTTCAAGATCG
TGTCGTGGTACGATAACGAGTGGGGGTACTCGCACCGCGTTGTCGACCTTGTCCTGCACA
TGGCCAAGAAGGACCGCAGCGCAAAGCTATAAGGAACGTTGCACTCTGGTGGCTCCGTTG
TTGCGGAGACCACAGCGCAGTTTTTTCGTTTTTGGTGGGGTTATGCTCGAGGGTTGCTCG
CTTCGCTTTTCTTACCTTCTTTTTTTTTGTTGATGATGTGCGTGATGAGAGCGCCTTTGA
GTGTTTTTTATTTATGTTTTATTAGGAAAATGA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P22513|G3PG_TRYCR GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE, GLYCOSOMAL (GAPDH)   Goto Swissprot  
Score: 77.8  Expect: 3e-15
nr  BLAST report  
sp|P22513|G3PG_TRYCR GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE, GLYCOSOMAL (GAPDH) pir||DEUT1C glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12), glycosomal - Trypanosoma cruzi emb|CAA37079.1| (X52898) glyceraldehyde 3-phosphate dehydrogenase [Trypanosoma cruzi] emb|CAA37080.1| (X52898) glyceraldehyde 3-phosphate dehydrogenase [Trypanosoma cruzi]   Goto GenBank  
Score: 77.8  Expect: 2e-14
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.7863  indefinite