genoma.unsam.edu.ar :: tca :: tca-05e13.b1

Sequence

>tca-05e13.b1
CCACGCGTCCGTTTTTTTTTATTAAAATCCCCTTTGTAGATTACATACCTTATATAAAAC
ATACTACAATAGGCATAAATCCGGGTAATACACCACAAAGTTCACTACATTGACCGGATA
TAGTTGAATTATTTGTAGAAAATAATATTATTTCGTTACAACGACCGGGTATACAATCTA
CTTTTACACCTAAACTTGGTAACGTAAAAGAATGTATTACGTCTACTGCAGATAGTCATA
ATTTATATATAACTAAACTTAATAATGTCAATACATGATTACATTGTAAAAGACGTAAAT
CTCCAACAAGATAATCACTTTCTAATATCAAATTACTAAATATTGTAGTTTCACCAAAAA
TAAAAAAAAAA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P98023|COX2_TRYCR CYTOCHROME C OXIDASE POLYPEPTIDE II   Goto Swissprot  
Score: 192  Expect: 5e-49
nr  BLAST report  
sp|P98023|COX2_TRYCR CYTOCHROME C OXIDASE POLYPEPTIDE II pir||A49872 cytochrome-c oxidase (EC 1.9.3.1) chain II - Trypanosoma cruzi mitochondrion (strain Tulahuen) gb|AAA16806.1| (L22643) cytochrome oxidase subunit II [Trypanosoma cruzi]   Goto GenBank  
Score: 192  Expect: 3e-48
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.0148  coding