genoma.unsam.edu.ar :: tca :: tca-05f21.b1

Sequence

>tca-05f21.b1
CCACGCGTCCGATGTCATTGCATGCATTGGCGAAACACTGAAGGAGCGCGAGGCGGGCCG
CACCGCGTCGGTTGTACTCACTCAGCTCGCGGCTATTGCGAAGCGACTCAAGAAGGAGGA
CTGGAGCCGTATTGTCGTTGCCTACGAGCCCGTATGGGCCATCGGCACGGGCAAGGTCGC
GACGCCACAGCAGGCACAGGAGGTGCACCATCTGCTCCGACAATGGGTTCAGGACAAGAT
CGGAGATGATGTGGCATCGCAGCTCCGCATTCTCTATGGAGGATCTGTGACCGCTGGCAA
CGCGAAGACACTCTATCAGATGGCTGACATCAACGGATTTCTC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P52270|TPIS_TRYCR TRIOSEPHOSPHATE ISOMERASE, GLYCOSOMAL (TIM)   Goto Swissprot  
Score: 213  Expect: 3e-55
nr  BLAST report  
sp|P52270|TPIS_TRYCR TRIOSEPHOSPHATE ISOMERASE, GLYCOSOMAL (TIM) pdb|1CI1|B Chain B, Crystal Structure Of Triosephosphate Isomerase From Trypanosoma Cruzi In Hexane pdb|1CI1|A Chain A, Crystal Structure Of Triosephosphate Isomerase From Trypanosoma Cruzi In Hexane gb|AAB58349.1| (U53867) triosephosphate isomerase [Trypanosoma cruzi]   Goto GenBank  
Score: 213  Expect: 2e-54
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.2277  coding