genoma.unsam.edu.ar :: tca :: tca-05h16.b1

Sequence

>tca-05h16.b1
CCACGCGTCCGCACGAAGGGCGCGAACGAGGCAACCAAGGCATTGAACCGCGGCATAGCG
GACCTAATCGTTTTGGCGGGAGATACAAATCCTATTGAAATTCTACTTCATCTTCCTCTT
CTTTGTGAAGACAAGAATGTGCCTTATGTCTTTGTGCCATCGAAAACGGCACTTGGTCGC
GCGGCGCAAGTCTCTCGCAATGTAGTTGCTCTTGCTATACTACAGTCTGAGAACAGCCCC
ATATCTTCGAAGGTCCAAGCTGTAAAACTTGAGATTG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q9U3Z7|NHPX_DROME NHP2-LIKE PROTEIN (HOI-POLLOI PROTEIN)   Goto Swissprot  
Score: 124  Expect: 2e-28
nr  BLAST report  
gb|AAG23161.1|AF263280_2 (AF263280) NHP2/RS6-like protein [Trypanosoma brucei]   Goto GenBank  
Score: 166  Expect: 2e-40
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.036  coding