genoma.unsam.edu.ar :: tca :: tca-05h20.b1

Sequence

>tca-05h20.b1
CCACGCGTCCCAAGCGGCCGAATTGTGAGAACGCAAAAATGTTCCGATCAGCTCTGACAA
TCGGTAAGCGTTCATACCTTAATGCTTTTAATGCTAAAGCCAAAGCACGACCAAATTTCG
GCCTCCGGGGAGTGGGTTTTTGGACCAATGAGGTCTATCATAAGCCTGGGCAGAACTACT
GGATGGCCCTTTGTGTGGCTGGAC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAB50889.1| cytochrome c oxidase subunit 9 {N-terminal} [Crithidia fasciculata=insect trypanosomatids, Peptide Mitochondrial Partial, 35 aa]   Goto GenBank  
Score: 64.3  Expect: 1e-09
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.8233  indefinite